HLA Reporting Implementation Guide
0.0.1 - Draft

HLA Reporting Implementation Guide - Local Development build (v0.0.1). See the Directory of published versions

: HLA-A*01:01:01:01 Allele Example - XML Representation

(back to description)

Raw xml

Source view


<Observation xmlns="http://hl7.org/fhir">
  <id value="HLA-A-AlleleExample1"/>
  <meta>
    <profile
             value="http://fhir.nmdp.org/ig/hla-reporting/StructureDefinition/hla-allele"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml"><p><b>Generated Narrative with Details</b></p><p><b>id</b>: HLA-A-AlleleExample1</p><p><b>meta</b>: </p><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style="background: LightGoldenRodYellow">(Details : {http://terminology.hl7.org/CodeSystem/observation-category code 'laboratory' = 'Laboratory)</span></p><p><b>code</b>: Haplotype name <span style="background: LightGoldenRodYellow">(Details : {LOINC code '84414-2' = 'Haplotype name)</span></p><p><b>value</b>: hla#3.25.0#HLA-A*01:01:01:01 <span style="background: LightGoldenRodYellow">(Details : {http://glstring.org code 'hla#3.25.0#HLA-A*01:01:01:01' = 'hla#3.25.0#HLA-A*01:01:01:01)</span></p><p><b>derivedFrom</b>: <a href="MolecularSequence-HLA-A-SequenceExample1.html">Generated Summary: id: HLA-A-SequenceExample1; type: dna; 0; observedSeq: CAGGAGCAGAGGGGTCAGGGCGAAGTCCCAGGGCCCCAGGCGTGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGTATGGATTGGGGAGTCCCAGCCTTGGGGATTCCCCAACTCCGCAGTTTCTTTTCTCCCTCTCCCAACCTACGTAGGGTCCTTCATCCTGGATACTCACGACGCGGACCCAGTTCTCACTCCCATTGGGTGTCGGGTTTCCAGAGAAGCCAATCAGTGTCGTCGCGGTCGCTGTTCTAAAGTCCGCACGCACCCACCGGGACTCAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCCAGACCTGGGCGGGTGAGTGCGGGGTCGGGAGGGAAACCGCCTCTGCGGGGAGAAGCAAGGGGCCCTCCTGGCGGGGGCGCAGGACCGGGGGAGCCGCGCCGGGAGGAGGGTCGGGCAGGTCTCAGCCACTGCTCGCCCCCAGGCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCCCTCATCCCCCACGGACGGGCCAGGTCGCCCACAGTCTCCGGGTCCGAGATCCACCCCGAAGCCGCGGGACTCCGAGACCCTTGTCCCGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCGGGTTGGTCGGGGCGGGGCGGGGCTCGGGGGACTGGGCTGACCGCGGGGTCGGGGCCAGGTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGGGTACCAGGGGCCACGGGGCGCCTCCCTGATCGCCTATAGATCTCCCGGGCTGGCCTCCCACAAGGAGGGGAGACAATTGGGACCAACACTAGAATATCACCCTCCCTCTGGTCCTGAGGGAGAGGAATCCTCCTGGGTTTCCAGATCCTGTACCAGAGAGTGACTCTGAGGTTCCGCCCTGCTCTCTGACACAATTAAGGGATAAAATCTCTGAAGGAGTGACGGGAAGACGATCCCTCGAATACTGATGAGTGGTTCCCTTTGACACCGGCAGCAGCCTTGGGCCCGTGACTTTTCCTCTCAGGCCTTGTTCTCTGCTTCACACTCAATGTGTGTGGGGGTCTGAGTCCAGCACTTCTGAGTCTCTCAGCCTCCACTCAGGTCAGGACCAGAAGTCGCTGTTCCCTTCTCAGGGAATAGAAGATTATCCCAGGTGCCTGTGTCCAGGCTGGTGTCTGGGTTCTGTGCTCTCTTCCCCATCCCGGGTGTCCTGTCCATTCTCAAGATGGCCACATGCGTGCTGGTGGAGTGTCCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCCGTCAGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCAAGCCCCTCACCCTGAGATGGGGTAAGGAGGGAGATGGGGGTGTCATGTCTCTTAGGGAAAGCAGGAGCCTCTCTGGAGACCTTTAGCAGGGTCAGGGCCCCTCACCTTCCCCTCTTTTCCCAGAGCTGTCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGATCACTGGAGCTGTGGTCGCTGCCGTGATGTGGAGGAGGAAGAGCTCAGGTGGAGAAGGGGTGAAGGGTGGGGTCTGAGATTTCTTGTCTCACTGAGGGTTCCAAGCCCCAGCTAGAAATGTGCCCTGTCTCATTACTGGGAAGCACCTTCCACAATCATGGGCCGACCCAGCCTGGGCCCTGTGTGCCAGCACTTACTCTTTTGTAAAGCACCTGTTAAAATGAAGGACAGATTTATCACCTTGATTACGGCGGTGATGGGACCTGATCCCAGCAGTCACAAGTCACAGGGGAAGGTCCCTGAGGACAGACCTCAGGAGGGCTATTGGTCCAGGACCCACACCTGCTTTCTTCATGTTTCCTGATCCCGCCCTGGGTCTGCAGTCACACATTTCTGGAAACTTCTCTGGGGTCCAAGACTAGGAGGTTCCTCTAGGACCTTAAGGCCCTGGCTCCTTTCTGGTATCTCACAGGACATTTTCTTCCCACAGATAGAAAAGGAGGGAGTTACACTCAGGCTGCAAGTAAGTATGAAGGAGGCTGATGCCTGAGGTCCTTGGGATATTGTGTTTGGGAGCCCATGGGGGAGCTCACCCACCCCACAATTCCTCCTCTAGCCACATCTTCTGTGGGATCTGACCAGGTTCTGTTTTTGTTCTACCCCAGGCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTGTAAAGGTGAGAGCTTGGAGGGCCTGATGTGTGTTGGGTGTTGGGTGGAACAGTGGACACAGCTGTGCTATGGGGTTTCTTTGCGTTGGATGTATTGAGCATGCGATGGGCTGTTTAAGGTGTGACCCCTCACTGTGATGGATATGAATTTGTTCATGAATATTTTTTTCTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAGAGTTGTTCCTGCCCTTCCCTTTGTGACTTGAAGAACCCTGACTTTGTTTCTGCAAAGGCACCTGCATGTGTCTGTGTTCGTGTAGGCATAATGTGAGGAGGTGGGGAGAGCACCCCACCCCCATGTCCACCATGACCCTCTTCCCACGCTGACCTGTGCTCCCTCTCCAATCATCTTTCCTGTTCCAGAGAGGTGGGGCTGAGGTGTCTCCATCTCTGTCTCAACTTCATGGTGCACTGAGCTGTAACTTCTTCCTTCCCTATTAAAA</a></p><h3>Components</h3><table class="grid"><tr><td>-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td>*</td><td>Gene studied [ID] <span style="background: LightGoldenRodYellow">(Details : {LOINC code '48018-6' = 'Gene studied [ID])</span></td><td>HLA-A <span style="background: LightGoldenRodYellow">(Details : {http://www.genenames.org/geneId code 'HGNC:4931' = 'HLA-A', given as 'HLA-A'})</span></td></tr></table></div>
  </text>
  <status value="final"/>
  <category>
    <coding>
      <system value="http://terminology.hl7.org/CodeSystem/observation-category"/>
      <code value="laboratory"/>
    </coding>
  </category>
  <code>
    <coding>
      <system value="http://loinc.org"/>
      <code value="84414-2"/>
    </coding>
  </code>
  <valueCodeableConcept>
    <coding>
      <system value="http://glstring.org"/>
      <code value="hla#3.25.0#HLA-A*01:01:01:01"/>
    </coding>
  </valueCodeableConcept>
  <derivedFrom>
    <reference value="MolecularSequence/HLA-A-SequenceExample1"/>
  </derivedFrom>
  <component>
    <code>
      <coding>
        <system value="http://loinc.org"/>
        <code value="48018-6"/>
      </coding>
    </code>
    <valueCodeableConcept>
      <coding>
        <system value="http://www.genenames.org/geneId"/>
        <code value="HGNC:4931"/>
        <display value="HLA-A"/>
      </coding>
    </valueCodeableConcept>
  </component>
</Observation>